Search
Search Funnelback University
- Refined by:
- Date: 2023
41 -
60 of
69
search results for `Watson Crick`
Fully-matching results
-
1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
PowerPoint Presentation
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2014-11-04-slides-cleevely.pdf9 Jul 2023: Crick & Watson. Solexa (acquired by Illumina in. 2006). CAT (acquired by AstraZeneca. -
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1). -
1984 - César Milstein & Georges Köhler - MRC Laboratory of…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1984-cesar-milstein-georges-kohler/21 Jul 2023: 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
DNA methylation in Marchantia polymorpha
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts -
pq079903507p
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots. -
Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072, -
2002 - Sydney Brenner, Bob Horvitz & John Sulston - MRC…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2002-sydney-brenner-bob-horvitz-john-sulston/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Doudna_pages 1..9
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Doudna2014.pdf14 Aug 2023: at the 5 side that determines the DNA tar-. get site by Watson-Crick base-pairing and. ... DNAtarget site by Watson-Crick base pairing, and thedouble-stranded structure at the 3′ side of theguide sequence that binds to Cas9 (64) (Fig. -
RR944 - Synthetic biology: A review of the technology, and current…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/HSE_rr944.pdf14 Aug 2023: Elucidation of the relationship between DNA, RNA and proteins by Watson, Crick and co-workers in the 1950s through discovery of the structure of the double helix. -
Annual Report of The Churchill Archives Centre 2022-2023 2023 ...
https://archives.chu.cam.ac.uk/wp-content/uploads/sites/2/2024/06/Annual-report-2022-23-final.pdf27 Sep 2023: The first was a book launch for Howard Markel’s new. work on the discovery of the Double Helix, entitled The secret of life: Rosalind Franklin, James Watson, Francis Crick,. ... 2 large boxes. 13/7/22 CRICK, Francis MISC 90 2218 9 papers by Francis -
INTERNATIONAL UNION FOR CONSERVATION OF NATURE Genetic frontiers for…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/2019-012-En-Syn.pdf14 Aug 2023: It was not until the mid-20th century, when James Watson, Francis Crick, and Rosalind. -
Synthetic biology josi q7v2:Synthetic biology
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/RAE_Synthetic_biology.pdf14 Aug 2023: A good starting point for a discussion of thedevelopments in biology is the publication in April 1953 of Jim Watson andFrancis Crick’s paper on the structure of the double helix9. ... At the 50th. Anniversary Celebration of the publication of their -
Copyright © National Academy of Sciences. All rights reserved. ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/SixAcademies_13316.pdf14 Aug 2023: helix structure of deoxyribonucleic acid (DNA) by scientists James Watson and Francis Crick (See Box 2-1). ... 1941: First functional program-controlled computer (Konrad Zuse) 1953: Crick and Watson describe the double helix structure of DNA 1960: First -
RR944 - Synthetic biology: A review of the technology, and current…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/HSE_SynBio_rr944.pdf14 Aug 2023: Elucidation of the relationship between DNA, RNA and proteins by Watson, Crick and co-workers in the 1950s through discovery of the structure of the double helix. • -
integratedproducts developmentscientific areassynthetic base type-in…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/SyntheticBiologyRoadmap.pdf14 Aug 2023: The discovery by James Watson and Francis Crick of the structure of DNA in 1953 and seminal follow-up work by Crick in 1961 that cracked the DNA-to-protein code, -
Ethics Debates on Synthetic Biology in the Three Regions ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/cpe_gest_D5-2.pdf14 Aug 2023: Ethics Debates on Synthetic Biology. in the Three Regions. Lead Authors: Dirk Stemerding, Virgil Rerimassie (Rathenau. Instituut), Ravi Srinivas (RIS), Wenxia Zhang (CASTED). This report represents Deliverable 5.2 for Global Ethics in Science & -
Copyright © National Academy of Sciences. All rights reserved. ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/IndustrialisationBiology.pdf14 Aug 2023: Today, we are at a new inflection point. The tremendous progress in biology over the past half century—from Watson and Crick’s elucidation of the structure of DNA to -
Engineered biosynthesis of natural products in heterologous hosts
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-2/Luo2015.pdf14 Aug 2023: crisis.4 The first revolution of biology was evidencedby the discovery of the double helix structure of DNA by JamesWatson and Francis Crick, while the second revolution began withthe human genome -
Beyond editing: repurposing CRISPR–Cas9 for precision genome…
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Dominguez2016.pdf14 Aug 2023: Although RNAi is a convenient tool for studying gene function, allowing transcript-specific degradation through Watson–Crick base-pairing between mRNAs and siRNAs or shRNAs, its effects can be inefficient and
Search history
Recently clicked results
Recently clicked results
Your click history is empty.
Recent searches
Recent searches
Your search history is empty.