Search

Search Funnelback University

Search powered by Funnelback
1 - 20 of 20 search results for `Watson Crick`
  1. Fully-matching results

  2. Science in Peace and War: The Secret of Life - Churchill College

    https://www.chu.cam.ac.uk/event/howard-markel-the-secret-of-life/
    Thumbnail for Science in Peace and War: The Secret of Life - Churchill College 22 Oct 2022: Come and hear Howard Markel, author of The Secret of Life – Rosalind Franklin, James Watson, Francis Crick and the Discovery of DNA’s Double Helix, speak at this event. ... But in truth, five towering minds were in pursuit of this advancement: Watson,
  3. Nobel Laureates of Cambridge

    https://www.cam.ac.uk/stories/cambridge-nobel-laureates
    Thumbnail for Nobel Laureates of Cambridge 30 Sep 2022: Francis Crick (Gonville and Caius College and Churchill College) and James Watson (Clare College).
  4. Career spotlight: Giulia Biffi - Johnian

    https://johnian.joh.cam.ac.uk/news/career-spotlight-giulia-biffi/
    Thumbnail for Career spotlight: Giulia Biffi - Johnian 18 Mar 2022: Watson, Crick and Franklin, are secondary structures of DNA.
  5. LMB Through the Years: 60 years of memories - MRC Laboratory of…

    https://www2.mrc-lmb.cam.ac.uk/lmb-through-the-years-60-years-of-memories/
    Thumbnail for LMB Through the Years: 60 years of memories - MRC Laboratory of Molecular Biology 15 Dec 2022: He recalls his first encounters with Francis Crick and Sydney Brenner, his work on the triplet code, the move into the new LMB and the epic series of parties following the ... announcement of Kendrew and Perutz’s Nobel Prize for Chemistry and Crick and
  6. Fred Sanger at the LMB - MRC Laboratory of Molecular Biology

    https://www2.mrc-lmb.cam.ac.uk/news-and-events/lmb-news/fred-sanger-at-the-lmb-2/
    Thumbnail for Fred Sanger at the LMB - MRC Laboratory of Molecular Biology 6 Oct 2022: A step to proving this was the deduction of the molecular structure of DNA by Francis Crick and James Watson, using X-ray diffraction patterns of DNA crystals by Maurice Wilkins ... There was a lot of pressure to get on to DNA, particularly from Crick.
  7. History

    www.tcm.phy.cam.ac.uk/about/history/
    22 Jul 2022: for the first time, Pippard introducing the concept of coherence length in superconductivity, David Tabor's work on surface physics, crystallography (including the recent work of Francis Crick and James Watson
  8. Biological sequence analysis: Probabilistic models of proteins and…

    https://www.cl.cam.ac.uk/teaching/2223/Bioinfo/papers/RNApredictionDurbin.pdf
    19 Oct 2022: This has the advantage that itmakes no assumptions about WatsonCrick base pairing, so mutual in-formation can be detected between covarying non-canonical pairs likeA-A and G-G pairs. ... Write down an alternative information theoretic measure
  9. APRIL 2022 ISSUE 27 Leverhulme Centre for Life in ...

    https://www.phy.cam.ac.uk/files/cavmag_27_2022_digital.pdf
    4 May 2022: 16. (1951) and the atomic parameters of this compound are now accurate to within 0.02 Å.’ ( Watson and Crick 1954). ... Watson and Crick could not have made their dramatic discovery of matching up the base pairs without June’s expert
  10. When does open science work? | petermr's blog

    https://blogs.ch.cam.ac.uk/pmr/2007/08/17/when-does-open-science-work/
    17 Jan 2022: A few seconds – such as the Watson-Crick DNA model or the Franklin data can communicate the whole message in a few seconds.
  11. Issue 3 November 2022 We said goodbye to April, ...

    https://paediatrics.medschl.cam.ac.uk/files/2022/11/Newsletter-Edition-3.pdf
    14 Nov 2022: In 1953, the combined work of scientists Rosalind Franklin, James Watson, and Francis Crick.
  12. Bilim ve Din İlişkisi İçin Modeller Denis R. Alexander ...

    https://www.faraday.cam.ac.uk/wp-content/uploads/2022/01/Faraday-Paper-3-Alexander_TR-v2.pdf
    15 Jan 2022: sonunda konu Watson ve Crick tarafından çözüldü: çift sarmal. model aslında DNA'nın1 yapısını tanımlamanın en iyi yolunu. ... dünyada, "bilim" terimi, yaygın olarak, üniversitelerin fakülte. 1 Watson J.D. and Crick F.H.C.
  13. Geometrical Constraints on the Tangling of Bacterial Flagellar…

    www.damtp.cam.ac.uk/user/mt599/papers/2020-scirep.pdf
    10 May 2022: References 1. Watson, J. D. & Crick, F. H. C. Molecular structure of nucleic acids: A structure for deoxyribose nucleic acid.
  14. Cambridge Scientists and Explorers, 16th Century to the Present ...

    https://www.girton.cam.ac.uk/sites/default/files/2022-10/Cambridge%20Scientists%20and%20Explorers%20course%20outline%202023_0.pdf
    28 Oct 2022: We will focus on the discoveries and contributions of selected mathematicians, physicists, biologists, chemists and explorers including Sir Isaac Newton, Charles Darwin, James Watson, Rosalind Franklin and Francis Crick - the discoverers
  15. Fellows' and Members' News 2000s

    https://www.joh.cam.ac.uk/sites/default/files/inline-files/Fellows%27_%26_Members%27_News_2000s%20without%20birthdates.pdf
    10 Oct 2022: with GlaxoWellcome. WATSON (nee Mcintyre), Anne L., and David WATSON (1982).
  16. Introduction UKRI Medical Research Council (MRC) scientists in…

    https://www.mrc-bsu.cam.ac.uk/wp-content/uploads/2020/06/MRC-ACTIVITY-BOOK-2020.pdf
    3 Aug 2022: This structure was discovered by LMB scientists, James Watson and Francis Crick, following work by Rosalind Franklin and Maurice Wilkins.
  17. petermr's blog | A Scientist and the Web | Page 8

    https://blogs.ch.cam.ac.uk/pmr/page/8/
    17 Jan 2022: Here’s an example () :. In 1953, the following sentence appeared near the end of a neat little paper by James Watson and Francis Crick proposing the double helical structure of DNA
  18. petermr's blog | A Scientist and the Web | Page 168

    https://blogs.ch.cam.ac.uk/pmr/page/168/
    17 Jan 2022: A few seconds – such as the Watson-Crick DNA model or the Franklin data can communicate the whole message in a few seconds.
  19. Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...

    https://www.cl.cam.ac.uk/teaching/2223/Bioinfo/papers/tutorial.pdf
    9 Oct 2022: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1).
  20. The Eagle 2005

    https://www.joh.cam.ac.uk/sites/default/files/inline-files/Eagle_2005%20no%20birthdates_1.pdf
    10 Oct 2022: The Eagle is published annually by St John's College, Cambridge, and se. nt free. of charge to members of St John's College and other interested parties. Articles. to be considered for publication should be addressed to: The Editor, The. Eagle,. St
  21. ContentMine at WOSP2014: Text and Data Mining: III What…

    https://blogs.ch.cam.ac.uk/pmr/2014/09/16/contentmine-at-wosp2014-text-and-data-mining-iii-what-elseviers-chris-shillum-thinks-we-can-do-responsible-mining/
    17 Jan 2022: Here’s an example () :. In 1953, the following sentence appeared near the end of a neat little paper by James Watson and Francis Crick proposing the double helical structure of DNA

Refine your results

Format

Search history

Recently clicked results

Recently clicked results

Your click history is empty.

Recent searches

Recent searches

Your search history is empty.