Search
Search Funnelback University
- Refined by:
- Date: Past year
1 -
50 of
77
search results for `Watson Crick`
Fully-matching results
-
1962 - Francis Crick & James Watson - MRC Laboratory of Molecular …
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-francis-crick-james-watson/21 Jul 2023: Search this website. 1962 – Francis Crick & James Watson. “for their discoveries concerning the molecular structure of nucleic acids and its significance for information transfer in living material”. ... 2024 MRC Laboratory of Molecular Biology,.
-
Nobel Prize | University of Cambridge
https://www.cam.ac.uk/research/research-at-cambridge/nobel-prize18 Oct 2023: Meet our Nobel Laureates 121 Nobel Prizes have been awarded to members of the University of Cambridge for significant advances. These include: the discovery of -
Cambridge ReseARch Trail
https://www.cam.ac.uk/stories/cambridge-ar-trail14 Mar 2024: The trail will take you past Colleges and Departments as well as a trip past The Eagle pub where Francis Crick and James Watson announced they had "discovered the secret of
-
Books - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/about-lmb/archive/books/21 Jul 2023: DNA. The Big Idea: Crick, Watson & DNA. Strathern, Paul. London: Arrow Books, 1997. ... DNA50 Council. London: Faircount Ltd, 2003. Paperback, 176pp, ISBN 1-84369-256-2. Includes: Articles about Crick, Watson, Franklin and DNA.
-
The LMB- present and future… University of Cambrigde
https://www.medschl.cam.ac.uk/lmb-past-present-future/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009). -
https://www.medschl.cam.ac.uk/tag/lmb/feed/
https://www.medschl.cam.ac.uk/tag/lmb/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
Bart Barrell (1944-2023) - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/bart-barrell-1944-2023/6 Dec 2023: Physiology or Medicine Prize to Francis Crick, James Watson and Maurice Wilkins for determining the structure of DNA, and the 1962 Chemistry Prize to Max Perutz and John Kendrew for their ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge
-
Why Cambridge? - Trinity Hall Cambridge
https://www.trinhall.cam.ac.uk/study-with-us/why-cambridge/30 Oct 2023: As well as college Bars, there are plenty of pubs in Cambridge, including the famous Eagle pub where Francis Crick announced that he and James Watson had discovered the ‘secret of
-
Cambridge Children’s Hospital – Treating the whole child |…
https://www.stemcells.cam.ac.uk/news/cambridge-childrens-hospital-treating-whole-child23 Feb 2024: The Centre for Genomic Medicine. It’s hard to think of a better place for a groundbreaking centre for genomic medicine than the university of Franklin, Crick, Watson and Sanger – and, -
Achievements - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/7 Feb 2024: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Fast Facts - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/about-lmb/fast-facts/21 Jul 2023: Francis Crick and Jim Watson helped unravel the structure of DNA – one of the scientific landmarks of the 20th century – in the MRC Unit. ... In 1962, the LMB was awarded 2 separate Nobel Prizes: Francis Crick and Jim Watson (Physiology or Medicine),
-
EMBO Awards - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/embo-awards/10 Jan 2024: 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Recordings - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/about-lmb/archive/recordings/21 Jul 2023: Part 1: James Watson and Francis Crick tell their personal stories of the early days of DNA research and of the historic discovery that set the world of science on its ... Isaac Asimov introduces James Watson and Francis Crick in the story of the
-
Royal Society Awards - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/royal-society-awards/16 May 2024: 1975 – Francis Crick In recognition of his elucidation of the structure of DNA and his continuing contribution to molecular biology. ... 1972 – Francis Crick In recognition of his elucidation of the structure of DNA and his continuing contribution to
-
Scientific Models - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/about-lmb/archive/scientific-models/21 Jul 2023: On display, LMB Library. Reproduction of Watson & Crick’s 1953 skeletal model. ... Base plate from the Watson and Crick 1953 model. Signed by Francis Crick and Jim Watson.
-
Academy of Medical Sciences - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/academy-medical-sciences/21 May 2024: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
History of the LMB - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/about-lmb/history-of-the-lmb/21 Jul 2023: Nobel Prize for Physiology or Medicine: Francis Crick and Jim Watson. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
LMB Nobel Prizes - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
LMB Nobel Facts - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/nobel-facts/21 Jul 2023: 1962 - Francis Crick & Jim Watson (Physiology or Medicine). 1958 - Fred Sanger (Chemistry). ... In 1962, the LMB was awarded 2 separate Nobel Prizes: Francis Crick and Jim Watson (Physiology or Medicine), and Max Perutz and John Kendrew (Chemistry).
-
Joan A. Steitz Postdoc Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/steitz-postdoc-prize/24 Oct 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Perutz Student Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-student-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/…
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
Dan Brown's Publications List - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/dan-browns-publications-list/21 Jul 2023: Base Pairing of Cytosine Analogues with Adenine and Guanosine in Oligonucleotide Duplexes: Evidence for Exchange between Watson-Crick and Wobble Base Pairs using IH NMR Spectroscopy. ... Search. Search this website. 2024 MRC Laboratory of Molecular
-
2017 - Richard Henderson - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2017-richard-henderson/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Recent events: video - Churchill Archives Centre
https://archives.chu.cam.ac.uk/online-resources/recent-events-video/12 Oct 2023: Quick Links. Back. Back. Back. Back. Back. Search our website. You are here:. Recent events: video. Recent events: video. A selection of recent events which were recorded and are now available online. All these videos and more are available on
-
LMB 365 - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/news-and-events/lmb-365/21 Jul 2023: Day 302 of #LMB365 shows the LMB Governing Board in 1967: Hugh Huxley, John Kendrew, Max Perutz, Francis Crick, Fred Sanger and Sydney Brenner. ... This was the LMB’s second Nobel for 1962, Francis Crick and James Watson had already been awarded the
-
HPS: Part IB exam papers 2003
https://www.hps.cam.ac.uk/files/past-ib-2003.pdf24 Jul 2023: Was it? Or (b) ‘Rather than believe that Watson and Crick made the DNA structure, I would. ... rather stress that the structure made Watson and Crick’ (FRANCIS CRICK). -
Eileen Southgate Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/eileen-southgate-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
topicsinqm
www.damtp.cam.ac.uk/user/tong/aqm/topics6.pdf2 Jul 2024: 6. Scattering Theory. The basic idea behind scattering theory is simple: there’s an object that you want to. understand. So you throw something at it. By analysing how that something bounces. o, you can glean information about the object itself. A -
Biological sequence analysis: Probabilistic models of proteins and…
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/RNApredictionDurbin.pdf3 Oct 2023: This has the advantage that itmakes no assumptions about Watson–Crick base pairing, so mutual in-formation can be detected between covarying non-canonical pairs likeA-A and G-G pairs. ... Write down an alternative information theoretic measure -
1982 - Aaron Klug - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1982-aaron-klug/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Preprint typeset in JHEP style - HYPER VERSION Lent ...
www.damtp.cam.ac.uk/user/tong/aqm/topicsinqm.pdf2 Jul 2024: It was. used by Franklin, Crick and Watson to understand the structure of DNA. -
Preprint typeset in JHEP style - HYPER VERSION Lent ...
www.damtp.cam.ac.uk/user/tong/relativity/dynrel.pdf3 Jul 2024: Preprint typeset in JHEP style - HYPER VERSION Lent Term, 2013. Dynamics and RelativityUniversity of Cambridge Part IA Mathematical Tripos. David Tong. Department of Applied Mathematics and Theoretical Physics,. Centre for Mathematical Sciences,. -
1980 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1980-fred-sanger/21 Jul 2023: with people like Francis Crick around it was difficult to ignore nucleic acids or to fail to realise the importance of sequencing them.”. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Great British Railway Journeys visits LMB to learn about the…
https://www2.mrc-lmb.cam.ac.uk/great-british-railway-journeys-visits-lmb-to-learn-about-the-significance-of-the-discovery-of-the-structure-of-dna/17 Jul 2023: of the double helix structure of DNA by James Watson and Francis Crick. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/…
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
1958 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1958-fred-sanger/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Introduction UKRI Medical Research Council (MRC) scientists in…
https://www.mrl.ims.cam.ac.uk/wp-content/uploads/2020/07/ACTIVITY-BOOK-2020.pdf15 Feb 2024: This structure was discovered by LMB scientists, James Watson and Francis Crick, following work by Rosalind Franklin and Maurice Wilkins. -
1997 - John Walker - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1997-john-walker/21 Jul 2023: Search. Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1). -
DNA methylation in Marchantia polymorpha
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts -
pq079903507p
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots. -
Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072, -
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json4 Oct 2023: {"movies": {"1": {"movie_id": "tt0012349", "title": "The Kid", "year": 1921, "type": "movie", "minutes": 68, "genres": ["Comedy", "Drama", "Family"], "rating": 8.3, "rating_votes": 130363, "actors": [{"person_id": "nm0088471", "name": "B.F. Blinn", -
1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Southern Africa students visit Cambridge Cancer Group - Primary Care…
https://www.phpc.cam.ac.uk/pcu/southern-africa-students-students-visit-cambridge-cancer-group/24 Feb 2024: Coming from a background in molecular sciences, one of my Cambridge highlights was tracing around the places were Watson and Crick worked and lived, going right up to The Eagle, where -
1984 - César Milstein & Georges Köhler - MRC Laboratory of…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1984-cesar-milstein-georges-kohler/21 Jul 2023: 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Doudna_pages 1..9
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Doudna2014.pdf14 Aug 2023: at the 5 side that determines the DNA tar-. get site by Watson-Crick base-pairing and. ... DNAtarget site by Watson-Crick base pairing, and thedouble-stranded structure at the 3′ side of theguide sequence that binds to Cas9 (64) (Fig. -
PowerPoint Presentation
www.damtp.cam.ac.uk/user/pvl/u3ac_heidelberg_2023.pdf17 Aug 2023: Ernest Rutherford (1906)John Cockcroft & Ernest Walton (1951)Francis Crick & James Watson (1962)Roger Penrose (2020). ... Francis Crick and James Watson. Crick was a physicist who during WW2 worked on the development of mines. -
HPS: Part IB exam papers 2010
https://www.hps.cam.ac.uk/files/past-ib-2010.pdf24 Jul 2023: twentieth‐century physics? 11. Why did James Watson and Francis Crick hope to solve the problems of . biology using the “sharp, non‐emotional thinking” of physics and chemistry? (Watson).
Search history
Recently clicked results
Recently clicked results
Your click history is empty.
Recent searches
Recent searches
Your search history is empty.