Search

Search Funnelback University

Search powered by Funnelback
10 results 20 results 50 results
Relevance Date (Newest first) Date (Oldest first) Title (A-Z) Title (Z-A) Distance URL (A-Z) URL (Z-A) Shuffle
31 - 40 of 75 search results for `Watson Crick`

  1. Fully-matching results

  2. https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/…

    https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/feed/
    23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div

  3. 1958 - Fred Sanger - MRC Laboratory of Molecular Biology

    https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1958-fred-sanger/
    Thumbnail for 1958 - Fred Sanger - MRC Laboratory of Molecular Biology 21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.

  4. PowerPoint Presentation

    https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2014-11-04-slides-cleevely.pdf
    9 Jul 2023: Crick & Watson. Solexa (acquired by Illumina in. 2006). CAT (acquired by AstraZeneca.

  5. 1997 - John Walker - MRC Laboratory of Molecular Biology

    https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1997-john-walker/
    Thumbnail for 1997 - John Walker - MRC Laboratory of Molecular Biology 21 Jul 2023: Search. Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.

  6. Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...

    https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf
    3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1).

  7. DNA methylation in Marchantia polymorpha

    https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf
    14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts

  8. pq079903507p

    https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf
    14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots.

  9. Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887

    https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf
    14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072,

  10. https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json

    https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json
    4 Oct 2023: {"movies": {"1": {"movie_id": "tt0012349", "title": "The Kid", "year": 1921, "type": "movie", "minutes": 68, "genres": ["Comedy", "Drama", "Family"], "rating": 8.3, "rating_votes": 130363, "actors": [{"person_id": "nm0088471", "name": "B.F. Blinn",

  11. 1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…

    https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/
    Thumbnail for 1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular Biology 21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.

Refine your results

Format

clear all

Date

Related searches for `Watson Crick`

By site

Search history

Recently clicked results

Recently clicked results

Your click history is empty.

Recent searches

Recent searches

Your search history is empty.