Search
Search Funnelback University
- Refined by:
- Date: Past year
31 -
50 of
75
search results for `Watson Crick`
Fully-matching results
-
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/…
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
1958 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1958-fred-sanger/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. -
PowerPoint Presentation
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2014-11-04-slides-cleevely.pdf9 Jul 2023: Crick & Watson. Solexa (acquired by Illumina in. 2006). CAT (acquired by AstraZeneca. -
1997 - John Walker - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1997-john-walker/21 Jul 2023: Search. Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. -
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1). -
DNA methylation in Marchantia polymorpha
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts -
pq079903507p
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots. -
Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072, -
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json4 Oct 2023: {"movies": {"1": {"movie_id": "tt0012349", "title": "The Kid", "year": 1921, "type": "movie", "minutes": 68, "genres": ["Comedy", "Drama", "Family"], "rating": 8.3, "rating_votes": 130363, "actors": [{"person_id": "nm0088471", "name": "B.F. Blinn", -
1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. -
Southern Africa students visit Cambridge Cancer Group - Primary Care…
https://www.phpc.cam.ac.uk/pcu/southern-africa-students-students-visit-cambridge-cancer-group/24 Feb 2024: Coming from a background in molecular sciences, one of my Cambridge highlights was tracing around the places were Watson and Crick worked and lived, going right up to The Eagle, where -
1984 - César Milstein & Georges Köhler - MRC Laboratory of…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1984-cesar-milstein-georges-kohler/21 Jul 2023: 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. -
Doudna_pages 1..9
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Doudna2014.pdf14 Aug 2023: at the 5 side that determines the DNA tar-. get site by Watson-Crick base-pairing and. ... DNAtarget site by Watson-Crick base pairing, and thedouble-stranded structure at the 3′ side of theguide sequence that binds to Cas9 (64) (Fig. -
PowerPoint Presentation
www.damtp.cam.ac.uk/user/pvl/u3ac_heidelberg_2023.pdf17 Aug 2023: Ernest Rutherford (1906)John Cockcroft & Ernest Walton (1951)Francis Crick & James Watson (1962)Roger Penrose (2020). ... Francis Crick and James Watson. Crick was a physicist who during WW2 worked on the development of mines. -
HPS: Part IB exam papers 2010
https://www.hps.cam.ac.uk/files/past-ib-2010.pdf24 Jul 2023: twentieth‐century physics? 11. Why did James Watson and Francis Crick hope to solve the problems of . biology using the “sharp, non‐emotional thinking” of physics and chemistry? (Watson). -
PDF - The structure of serendipity - working paper
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/wp0507.pdf9 Jul 2023: Further serendipitous events followed to direct Watson and Crick’s efforts. One entailed. ... Watson, Crick, and Mullis could have achieved their breakthrough innovations without. -
2002 - Sydney Brenner, Bob Horvitz & John Sulston - MRC…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2002-sydney-brenner-bob-horvitz-john-sulston/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. -
RR944 - Synthetic biology: A review of the technology, and current…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/HSE_rr944.pdf14 Aug 2023: Elucidation of the relationship between DNA, RNA and proteins by Watson, Crick and co-workers in the 1950s through discovery of the structure of the double helix. -
The Predatory Paradox: Ethics, Politics, and Practices in…
https://api-thoth-arch.lib.cam.ac.uk/server/api/core/bitstreams/52bfc3d4-8c52-42ce-9001-335ac1f680d3/content16 May 2024: Crick (Watson and Crick 1953) published an article in Nature that established their double-helix model of DNA as the one that would be accepted as scientific fact for generations to ... At the time it was published, Avery and his coauthors’ paper -
INTERNATIONAL UNION FOR CONSERVATION OF NATURE Genetic frontiers for…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/2019-012-En-Syn.pdf14 Aug 2023: It was not until the mid-20th century, when James Watson, Francis Crick, and Rosalind.
Search history
Recently clicked results
Recently clicked results
Your click history is empty.
Recent searches
Recent searches
Your search history is empty.