Search
Search Funnelback University
- Refined by:
- Date: Past year
21 -
40 of
75
search results for `Watson Crick`
Fully-matching results
-
Perutz Student Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-student-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/…
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
Dan Brown's Publications List - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/dan-browns-publications-list/21 Jul 2023: Base Pairing of Cytosine Analogues with Adenine and Guanosine in Oligonucleotide Duplexes: Evidence for Exchange between Watson-Crick and Wobble Base Pairs using IH NMR Spectroscopy. ... Search. Search this website. 2024 MRC Laboratory of Molecular
-
2017 - Richard Henderson - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2017-richard-henderson/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Recent events: video - Churchill Archives Centre
https://archives.chu.cam.ac.uk/online-resources/recent-events-video/12 Oct 2023: Quick Links. Back. Back. Back. Back. Back. Search our website. You are here:. Recent events: video. Recent events: video. A selection of recent events which were recorded and are now available online. All these videos and more are available on
-
LMB 365 - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/news-and-events/lmb-365/21 Jul 2023: Day 302 of #LMB365 shows the LMB Governing Board in 1967: Hugh Huxley, John Kendrew, Max Perutz, Francis Crick, Fred Sanger and Sydney Brenner. ... This was the LMB’s second Nobel for 1962, Francis Crick and James Watson had already been awarded the
-
HPS: Part IB exam papers 2003
https://www.hps.cam.ac.uk/files/past-ib-2003.pdf24 Jul 2023: Was it? Or (b) ‘Rather than believe that Watson and Crick made the DNA structure, I would. ... rather stress that the structure made Watson and Crick’ (FRANCIS CRICK). -
Eileen Southgate Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/eileen-southgate-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
1982 - Aaron Klug - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1982-aaron-klug/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
1980 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1980-fred-sanger/21 Jul 2023: with people like Francis Crick around it was difficult to ignore nucleic acids or to fail to realise the importance of sequencing them.”. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/…
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
1958 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1958-fred-sanger/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
PowerPoint Presentation
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2014-11-04-slides-cleevely.pdf9 Jul 2023: Crick & Watson. Solexa (acquired by Illumina in. 2006). CAT (acquired by AstraZeneca. -
1997 - John Walker - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1997-john-walker/21 Jul 2023: Search. Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1). -
DNA methylation in Marchantia polymorpha
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts -
pq079903507p
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots. -
Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072, -
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json4 Oct 2023: {"movies": {"1": {"movie_id": "tt0012349", "title": "The Kid", "year": 1921, "type": "movie", "minutes": 68, "genres": ["Comedy", "Drama", "Family"], "rating": 8.3, "rating_votes": 130363, "actors": [{"person_id": "nm0088471", "name": "B.F. Blinn", -
1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
Search history
Recently clicked results
Recently clicked results
Your click history is empty.
Recent searches
Recent searches
Your search history is empty.