Search
Search Funnelback University
- Refined by:
- Date: Past year
21 -
70 of
75
search results for `Watson Crick`
Fully-matching results
-
Perutz Student Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-student-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/…
https://www.medschl.cam.ac.uk/tag/mrc-laboratory-of-molecular-biology/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
Dan Brown's Publications List - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/dan-browns-publications-list/21 Jul 2023: Base Pairing of Cytosine Analogues with Adenine and Guanosine in Oligonucleotide Duplexes: Evidence for Exchange between Watson-Crick and Wobble Base Pairs using IH NMR Spectroscopy. ... Search. Search this website. 2024 MRC Laboratory of Molecular
-
2017 - Richard Henderson - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2017-richard-henderson/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Recent events: video - Churchill Archives Centre
https://archives.chu.cam.ac.uk/online-resources/recent-events-video/12 Oct 2023: Quick Links. Back. Back. Back. Back. Back. Search our website. You are here:. Recent events: video. Recent events: video. A selection of recent events which were recorded and are now available online. All these videos and more are available on
-
LMB 365 - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/news-and-events/lmb-365/21 Jul 2023: Day 302 of #LMB365 shows the LMB Governing Board in 1967: Hugh Huxley, John Kendrew, Max Perutz, Francis Crick, Fred Sanger and Sydney Brenner. ... This was the LMB’s second Nobel for 1962, Francis Crick and James Watson had already been awarded the
-
HPS: Part IB exam papers 2003
https://www.hps.cam.ac.uk/files/past-ib-2003.pdf24 Jul 2023: Was it? Or (b) ‘Rather than believe that Watson and Crick made the DNA structure, I would. ... rather stress that the structure made Watson and Crick’ (FRANCIS CRICK). -
Eileen Southgate Prize - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/eileen-southgate-prize/24 Oct 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
1982 - Aaron Klug - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1982-aaron-klug/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
1980 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1980-fred-sanger/21 Jul 2023: with people like Francis Crick around it was difficult to ignore nucleic acids or to fail to realise the importance of sequencing them.”. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/…
https://www.medschl.cam.ac.uk/category/newsletter/newsletter-issue-21/feed/23 Feb 2024: ten Nobel Prizes, including Fred Sanger (1958 and 1980), Max Perutz and John Kendrew (1962), Jim Watson and Francis Crick (1962) and most recently, Venki Ramakrishnan (2009)./p div -
1958 - Fred Sanger - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1958-fred-sanger/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
PowerPoint Presentation
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2014-11-04-slides-cleevely.pdf9 Jul 2023: Crick & Watson. Solexa (acquired by Illumina in. 2006). CAT (acquired by AstraZeneca. -
1997 - John Walker - MRC Laboratory of Molecular Biology
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1997-john-walker/21 Jul 2023: Search. Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo ...
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/tutorial.pdf3 Oct 2023: DNA coding strand (aka Crick strand, strand 1). 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’|||||||||||||||||||||||||||||||||||||||. ... 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’DNA template strand (aka Watson strand, strand 1). -
DNA methylation in Marchantia polymorpha
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/AguilarCruz2019.pdf14 Aug 2023: 5) RNA POLYMERASE V (POLV) itself helps recruit the activity of the de novo DNA methyltransferase DOMAINSREARRANGED METHYLTRANSFERASE 2 (DRM2) by generating long ssRNA that through Watson–Crick base pairing interacts -
pq079903507p
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Ayre99.pdf14 Aug 2023: Watson-Crick base paring is indicated by u, and G:U base pairs are representedby dots. -
Cold Spring Harb Perspect Biol-2017-Boehm-cshperspect.a023887
https://haseloff.plantsci.cam.ac.uk/resources/LabPapers/Boehm2017.pdf14 Aug 2023: Synthetic Botany. Christian R. Boehm,1,4 Bernardo Pollak,1,4 Nuri Purswani,2 Nicola Patron,3 and Jim Haseloff1. 1Department of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom2The IBM Place I, Singapore, 486072, -
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json
https://www.cl.cam.ac.uk/~jps79/movies.tinydb.json4 Oct 2023: {"movies": {"1": {"movie_id": "tt0012349", "title": "The Kid", "year": 1921, "type": "movie", "minutes": 68, "genres": ["Comedy", "Drama", "Family"], "rating": 8.3, "rating_votes": 130363, "actors": [{"person_id": "nm0088471", "name": "B.F. Blinn", -
1962 - John Kendrew & Max Perutz - MRC Laboratory of Molecular…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1962-john-kendrew-max-perutz/21 Jul 2023: Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Southern Africa students visit Cambridge Cancer Group - Primary Care…
https://www.phpc.cam.ac.uk/pcu/southern-africa-students-students-visit-cambridge-cancer-group/24 Feb 2024: Coming from a background in molecular sciences, one of my Cambridge highlights was tracing around the places were Watson and Crick worked and lived, going right up to The Eagle, where -
1984 - César Milstein & Georges Köhler - MRC Laboratory of…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/1984-cesar-milstein-georges-kohler/21 Jul 2023: 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Doudna_pages 1..9
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Doudna2014.pdf14 Aug 2023: at the 5 side that determines the DNA tar-. get site by Watson-Crick base-pairing and. ... DNAtarget site by Watson-Crick base pairing, and thedouble-stranded structure at the 3′ side of theguide sequence that binds to Cas9 (64) (Fig. -
PowerPoint Presentation
www.damtp.cam.ac.uk/user/pvl/u3ac_heidelberg_2023.pdf17 Aug 2023: Ernest Rutherford (1906)John Cockcroft & Ernest Walton (1951)Francis Crick & James Watson (1962)Roger Penrose (2020). ... Francis Crick and James Watson. Crick was a physicist who during WW2 worked on the development of mines. -
HPS: Part IB exam papers 2010
https://www.hps.cam.ac.uk/files/past-ib-2010.pdf24 Jul 2023: twentieth‐century physics? 11. Why did James Watson and Francis Crick hope to solve the problems of . biology using the “sharp, non‐emotional thinking” of physics and chemistry? (Watson). -
PDF - The structure of serendipity - working paper
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/wp0507.pdf9 Jul 2023: Further serendipitous events followed to direct Watson and Crick’s efforts. One entailed. ... Watson, Crick, and Mullis could have achieved their breakthrough innovations without. -
2002 - Sydney Brenner, Bob Horvitz & John Sulston - MRC…
https://www2.mrc-lmb.cam.ac.uk/achievements/lmb-nobel-prizes/2002-sydney-brenner-bob-horvitz-john-sulston/21 Jul 2023: Search this website. 2024 MRC Laboratory of Molecular Biology,. Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
RR944 - Synthetic biology: A review of the technology, and current…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/HSE_rr944.pdf14 Aug 2023: Elucidation of the relationship between DNA, RNA and proteins by Watson, Crick and co-workers in the 1950s through discovery of the structure of the double helix. -
The Predatory Paradox: Ethics, Politics, and Practices in…
https://api-thoth-arch.lib.cam.ac.uk/server/api/core/bitstreams/52bfc3d4-8c52-42ce-9001-335ac1f680d3/content16 May 2024: Crick (Watson and Crick 1953) published an article in Nature that established their double-helix model of DNA as the one that would be accepted as scientific fact for generations to ... At the time it was published, Avery and his coauthors’ paper -
INTERNATIONAL UNION FOR CONSERVATION OF NATURE Genetic frontiers for…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/2019-012-En-Syn.pdf14 Aug 2023: It was not until the mid-20th century, when James Watson, Francis Crick, and Rosalind. -
Annual Report of The Churchill Archives Centre 2022-2023 2023 ...
https://archives.chu.cam.ac.uk/wp-content/uploads/sites/2/2024/06/Annual-report-2022-23-final.pdf27 Sep 2023: The first was a book launch for Howard Markel’s new. work on the discovery of the Double Helix, entitled The secret of life: Rosalind Franklin, James Watson, Francis Crick,. ... 2 large boxes. 13/7/22 CRICK, Francis MISC 90 2218 9 papers by Francis -
Synthetic biology josi q7v2:Synthetic biology
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/RAE_Synthetic_biology.pdf14 Aug 2023: A good starting point for a discussion of thedevelopments in biology is the publication in April 1953 of Jim Watson andFrancis Crick’s paper on the structure of the double helix9. ... At the 50th. Anniversary Celebration of the publication of their -
Copyright © National Academy of Sciences. All rights reserved. ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/SixAcademies_13316.pdf14 Aug 2023: helix structure of deoxyribonucleic acid (DNA) by scientists James Watson and Francis Crick (See Box 2-1). ... 1941: First functional program-controlled computer (Konrad Zuse) 1953: Crick and Watson describe the double helix structure of DNA 1960: First -
RR944 - Synthetic biology: A review of the technology, and current…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/HSE_SynBio_rr944.pdf14 Aug 2023: Elucidation of the relationship between DNA, RNA and proteins by Watson, Crick and co-workers in the 1950s through discovery of the structure of the double helix. • -
integratedproducts developmentscientific areassynthetic base type-in…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/SyntheticBiologyRoadmap.pdf14 Aug 2023: The discovery by James Watson and Francis Crick of the structure of DNA in 1953 and seminal follow-up work by Crick in 1961 that cracked the DNA-to-protein code, -
Biological sequence analysis: Probabilistic models of proteins and…
https://www.cl.cam.ac.uk/teaching/2324/Bioinfo/papers/RNApredictionDurbin.pdf3 Oct 2023: This has the advantage that itmakes no assumptions about Watson–Crick base pairing, so mutual in-formation can be detected between covarying non-canonical pairs likeA-A and G-G pairs. ... Write down an alternative information theoretic measure -
Ethics Debates on Synthetic Biology in the Three Regions ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/cpe_gest_D5-2.pdf14 Aug 2023: Ethics Debates on Synthetic Biology. in the Three Regions. Lead Authors: Dirk Stemerding, Virgil Rerimassie (Rathenau. Instituut), Ravi Srinivas (RIS), Wenxia Zhang (CASTED). This report represents Deliverable 5.2 for Global Ethics in Science & -
Copyright © National Academy of Sciences. All rights reserved. ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/IndustrialisationBiology.pdf14 Aug 2023: Today, we are at a new inflection point. The tremendous progress in biology over the past half century—from Watson and Crick’s elucidation of the structure of DNA to -
Engineered biosynthesis of natural products in heterologous hosts
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-2/Luo2015.pdf14 Aug 2023: crisis.4 The first revolution of biology was evidencedby the discovery of the double helix structure of DNA by JamesWatson and Francis Crick, while the second revolution began withthe human genome -
Beyond editing: repurposing CRISPR–Cas9 for precision genome…
https://haseloff.plantsci.cam.ac.uk/resources/Part2SynBio_refs/Lecture-1/Dominguez2016.pdf14 Aug 2023: Although RNAi is a convenient tool for studying gene function, allowing transcript-specific degradation through Watson–Crick base-pairing between mRNAs and siRNAs or shRNAs, its effects can be inefficient and -
Microsoft PowerPoint - ISGC_Spring2019_Teaser_SD_mt
https://www.neurology.cam.ac.uk/wp-content/uploads/2019/01/International-Stroke-Genetics-Consortium-Workshop-Teaser-10-12th-April-2019.pdf16 Jan 2024: A drink at the Eagle Pub (top right), where Frances Crick announced his discovery (along with James Watson and Rosalind Franklin) of the structure of DNA. • -
National Strategy for Modernizing the Regulatory System for…
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/NSTC_biotech_national_strategy_2016.pdf14 Aug 2023: Watson, and Francis Crick laid the groundwork for an era of innovation in the life sciences. -
Great British Railway Journeys visits LMB to learn about the…
https://www2.mrc-lmb.cam.ac.uk/great-british-railway-journeys-visits-lmb-to-learn-about-the-significance-of-the-discovery-of-the-structure-of-dna/17 Jul 2023: of the double helix structure of DNA by James Watson and Francis Crick. ... Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK.
-
Preparing for Future Products of Biotechnology
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/NAS_FutureProducts_24605.pdf14 Aug 2023: DETAILS. Distribution, posting, or copying of this PDF is strictly prohibited without written permission of the National Academies Press. (Request Permission) Unless otherwise indicated, all materials in this PDF are copyrighted by the National -
Slide 1
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/2012-11-20-slides-raven.pdf9 Jul 2023: Cambridge ideas change the world. EDSAC Raspberry Pi. Crick & Watson Solexa (acquired by Illumina in 2006). ... Whittle Turing Darwin Rutherford Babbage Sanger……. Watson & Crick. 89 Nobel Prize Winners. -
Synthetic Biology: Influencing Development
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/Lloyds_SyntheticBiology_InfluencingDevelopment_2009.pdf14 Aug 2023: It has a double helix structure which was discovered in 1953 by Watson and Crick building on the work of Rosalind Franklin and Maurice Wilkins. ... History of biotech. The term “genetics” is introduced. Watson and Crick discover the structure of DNA. -
Microsoft PowerPoint - Inaugural Lecture_Mumbai_IMC_March 12.ppt…
https://www.jbs.cam.ac.uk/wp-content/uploads/2020/08/090312-mumbai.pdf9 Jul 2023: 1949 - Wilkes – first stored programme computer. • 1953 - Watson and Crick – DNA structure. • -
W97 binnenwerk-8
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/Rathenau-Constructing-Life-2006.pdf14 Aug 2023: A review of research on DNA’s secondary structure in Current Science in 2003 shows that the doublehelix model, developed by Watson & Crick in 1953, is not the onlytype of secondary -
Introduction UKRI Medical Research Council (MRC) scientists in…
https://www.mrl.ims.cam.ac.uk/wp-content/uploads/2020/07/ACTIVITY-BOOK-2020.pdf15 Feb 2024: This structure was discovered by LMB scientists, James Watson and Francis Crick, following work by Rosalind Franklin and Maurice Wilkins. -
F r o m p l a n t ...
https://haseloff.plantsci.cam.ac.uk/resources/SynBio_reports/vib_facts_series_fromplanttocrop_ENG.pdf14 Aug 2023: century accelerated plant modification. With the discovery of the structure of DNA by Watson and Crick.
Search history
Recently clicked results
Recently clicked results
Your click history is empty.
Recent searches
Recent searches
Your search history is empty.